Commit 0d985c0b authored by JCabral's avatar JCabral

add tests to seqtk

parent a3175750
......@@ -60,7 +60,15 @@
<tests>
<test>
<param name="type" value="paired" />
<param name="forward_pe" value="inputforward.fastq" />
<param name="reverse_pe" value="inputreverse.fastq" />
<param name="fastar" value="testref.fasta"/>
<param name="coverage" value="50" />
<output name="output" file="outputforward.fastq" />
<output name="output_rev" file="outputreverse.fastq" />
</test>
</tests>
<help>
What it does
......
This diff is collapsed.
This diff is collapsed.
This diff is collapsed.
This diff is collapsed.
>gi|360034408|ref|NC_016445.1|_2000000_2400000
CCCGCTCGCCACGCTTTGGCCATAGTGCTGCCTTCTACGATGTGTAAACCGTGCAACTTAATGCCATCGGTGCCTACCTT
CAGTACTTGCTGTAACGTGGTGAGGTTTTCAGTGCGCTCTTCACCGGGTAACCCAACAATCAAGTGAGTACACACTTTGA
TACCTAACGCTCTAGCTTTGGCAGTGATCTCTGCGTAGCAGGCAAAATCGTGCCCGCGGTTAATGCGTTTTAAAGTCTGG
TCGTGCGCCGTCTGTAAACCCAATTCAAGCCAAATTTCATAACCTTGCTGCACATAATCGGCGAGCAACTTAAGCACCGC
ATCCGGTACACAATCAGGACGAGTGCCAACACACAACCCCACAATATCCGCTTCTTCTAGGGCTTGTTCGTACATGGATT
TCAGCACTTGCACTTCCGCATACGTGCTGGTGTAAGCTTGAAAATAAGCGAGGTATTTTTTGGCGCGTTTGATCTCCCCC
GCCCGATCTTTCAACTGCGCTTGAATACTCTGCTGCTGAGTATTTTCATCGGCAAACGACGCCACATTACAGAAAGTGCA
GCCGCCACGGCCTATCGTGCCATCGCGATTCGGACAACTGAATCCACCATGCAGCGTTAACTTATGGACCTTCTCTCCAT
AACGGCGTTGTAAATCTTGACCTATGGTGTTCACCAGTTGATGTAAATGCATCGGCTCGCTCAATCTAAATACAAATATC
TCTCACTACCATCCGTGTAATTTAATTACATTTCCAATCGAATTGGTCACAAATTTTAATCCCTCGCGTTTGATTTCAAA
CAGCGTCAAATCAATAAATAGGCATAAAATAAACACTATTTGCATTTTGTTTCTAGTTTGTTAAACAAAACATTCATCTA
GCTGTAAAAAAATAAACCAAACCGCAGACTTTTCGTTGGAATTTGCGCCAGCAAAATTGTAGGATACTTTCAGTTTTCCG
TGCTTTTTTGCTCAATTAATTACAAAAAACGCGGCAGACTATCGGTGATATTCCACACCTACCAAAAGAATCCACTAGTA
AAGTGGCTCGACAACAGGAATGTCACTAAGGATTGTCTTTCTCACAATATATTTCCTGTGAGAGACGGAAAGGACGCGGA
TCTGCTCCCTAAGCAGATTTCACTCAAAACAAAAAGGACAGGACGTATCGCCCAAGCGACTCATTCAGCGGATGCTGCTT
GATGCGTGGCGGGAATAACTGAGTGCACACTCAGTGCGGTTGCGTCCTCAATAACTGGAAGGATGTATCTATGGTAGATA
AAGCGCAACGTTCGCGTGGTCTTTATACGCCTGAGCTGGAGCATGATGCTTGTGGCATCGGCTTTGTCGCTCACCTGAAA
AATCGCAAGTCTCATCAGGTGGTCACTCAAGCTTTGGACATGCTCGCACGCATGGAACACCGTGGCGGTCAGGGTTGTGA
CCCTTGCAGCGGTGACGGTGCGGGTATTTTGTTGCAAAAACCTCACGAATTTTTACTCGAAGAAGCGGTTAAACTGGGGA
TCAAGCTGCCTTCATTCGAAAAGTACGGTGTTGGTGTGGTGCTGTTCCCGAAAGATGAACATAAACGCGCCCAATGCCGC
GACATTCTAGAACGCAATGCCAAACGCCTTGATCTGGATGTGATTGGCTACCGCGTTTTACCGACCAATAACAGCATGTT
GGGTGCCGACCCCCTCAGTACCGAACCACAATTTGAACACGTGTTTATTTCTGGCGGCCCGGGTATGCAGCCTGACGAGC
TAGAACGCAAGCTGTACGTGCTGCGTAACTACACCGTTCGCGTCTGCCTTGAGAGCGTGTCGAACATCGGTGATGATTTT
TATATCAACTCGATGTCGTACAAAACCTTGGTCTATAAAGGTCAGTTGACTACAGAGCAAGTACCGCAATACTTCCTCGA
CTTGCAAAATCCGACCATGGTGACAGCGTTAGCACTGGTGCACTCGCGTTTTTCGACCAACACCTTCCCGAAATGGCGAC
TGGCTCAACCTTTCCGCTACATCGCGCACAACGGTGAGATCAACACGGTTCGCGGTAACTTGAACTGGATGAAAGCGCGC
GAAGCGATTTTACAATCCAAGCTGTTTACTCAAGCTGAAATCGATATGCTGCTGCCTATCTGCCAAGAAGGCGCATCCGA
TTCGGCTAACTTTGACATGGTACTCGAACTGCTGGTGCTTTCCGGTCGCAGCTTGCCTCACGCTCTGATGATGATGATCC
CAGAAGCATGGCAAGAAAACAAAGCGATGGATCCTAAGCGCCGCGCCTTCTATCAATACCACGCTAACGTCATGGAACCT
TGGGACGGCCCAGCATCAGTGTGCTTTACCGATGGGGTACAAGTAGGCGCCACACTGGATCGTAACGGTCTGCGTCCGTC
TCGTTATACCGTGACCAAAGACGATTTTCTGATCATGGCTTCCGAATCTGGCGTCGTGGAAATTGATCCGGCCAATGTGG
AATACCGTGGTCGTCTGCAACCGGGACGTATCTTTGTTGCCGACTTAGAACAAGGCCGTATTATCTCAGATGAAGAGGTG
AAAGACGGTATCGCTTCGGCGCAGCCTTATGAAAAATGGGTAGAAGAAAACCTACTCAGTTTGAAAAAACTGCCGGATGC
CGACAACGTACATAGCCAACCGTCGCCAGAGCGTCTCCTCCATCGCCAACAAGCGTTTGGGGTGAGTAGCGAAGAGGTCA
ATGACATCATTCTGACTCTCGCGCAAACTGGTTATGAGCCGCTCGGTTCGATGGGGGCAGACTGGCCGGTCGCCGTGCTG
TCACACCAATCTCAGCATCTCTCCAACTACTTCAAGCAGTTGTTTGCCCAAGTGACCAACCCACCGATCGACCCGATCCG
TGAACGCATGGTGATGTCGCTCAACACTTATATCGGCCGCGATCAAAACTTGCTAGCAGAAACCCCTGCGCACTGTCGTA
AGGTCGAATTGGAATCGCCGGTCATTTCTAATGCTGAGCTTGAGAAAATCCGGGCAATCGATAACGAGCACTTGCAAGCC
AAAACCTTAGACATCGTATTTCGTGCCAGCGATGAACCGGGCAAGCTCGAACGCGCTCTGAAACGTATTTGCCAATACGC
GGAAGATGCGGTGATTGATGGCTATTCGATCATTTTGCTGACCGACCGCGCGGTAAACTCCAACCACGCCGCCATCCCAG
CCATGCTGGCTGTAGGCGCGGTGCACCATCACCTGATCCGCAAAGGTCTGCGTTCGAAATGCGGCATTGTGGTGGAAACT
GGTGATGCGCGTGAAACGCACCACTTTGCAACCCTACTCGGCTACGGTGCAAACGCAGTCAACCCGTATCTAGTGGTGGA
AACCATCGTCGATCTCAAGCGTCAGAAGAAACTCGATGCCGATGTTTCGGTAGAGAAATACTTCGAGAATTACCGTAAAG
GCGTGAACGGCGGTCTGTTGAAGATCTTCTCTAAAATGGGGATTTCGACGCTGCAGTCTTATCACGGTGCACAGATTTTT
GAAGCGCTCGGGATCAGTAAAGCGGTGGTCGATAAATACTTCACTGGCACCATCACCCGTATTCAAGGTTTGACCCTCGA
CGACATCGCTAAAGAAGTGTTGGTTCGTCATCGCATTGGTTACCCAACGCGTGAAATCCCACTGCAAGTGCTGGATGTCG
GCGGCGTGTATCAATGGAAACAGCGTGGTGAGCAGCATCTGTTTAACCCAGAAACGATTCACCTGCTGCAAGAATCGACT
CGCCACAAAAATTATCAGCAGTTCAAGAAGTACGCAGCCGCGGTGGATAGCCAAGGCGATAAAGCCGTTACTCTGCGCAG
TCAGCTTGATTTTGTGAAAAATCCAGCGGGTTCCATTCCGATTGAGGAAGTGGAACCGATCGAGAGCATTGTGAAGCGCT
TTGCCACCGGTGCGATGTCGTTTGGGTCTATCTCTTACGAAGCGCACTCCACACTGGCGATTGCGATGAACCGTCTAGGC
GCGAAATCCAACTCCGGTGAAGGTGGTGAAGACCCAATGCGTTTTGAGCTAAATGCCAACGGTGATTCAGAGCGTTCAGC
GATCAAGCAAGTAGCATCTGGCCGTTTCGGCGTGACCTCTTACTATCTGACCAACGCAGATGAAATCCAGATCAAGATGG
CGCAAGGGGCGAAACCGGGCGAAGGTGGTCAGCTACCGGGTGATAAAGTCGATGAATGGATCGGGGCAACTCGTCACTCG
ACACCGGGCGTCGGCCTGATTTCGCCACCACCGCACCACGACATTTACTCTATCGAAGACTTAGCCCAGCTGATTTTCGA
TCTGAAAAACGCCAACCGCAAAGGTCGCGTCAACGTCAAACTGGTTTCTGAAGCCGGTGTCGGCACCATCGCATCGGGTG
TGGCTAAAGCCAAAGCTGACGTAGTACTGATTGCCGGTCACGATGGCGGTACGGGTGCATCACCCATCTCTTCTATCCGT
CATACCGGTTTACCTTGGGAACTGGGTCTGGCTGAAACCCACCAGACTCTGCTCAAAAACGGCCTGCGTAACCGCATTGT
GGTGCAAGCCGATGGACAGATGAAAACCCCACGCGATATCGCGATTGCGGTACTGTTGGGCGCTGAAGAATGGGGCGTCG
CAACCGCTGCACTGGTGGTTGAAGGCTGTATCATGATGCGTAAATGTCATAAAAACACTTGCCCTGTCGGTATCGCCACA
CAAAACAAAACTCTGCGTGAGCGTTTTGCTGGCCGTGTGGATGACGTTGTGACCTTCTTCCAATACATGGCACAAGGCCT
GCGTGAAATCATGGCTGAGCTCGGTTTCCGCACCATTAACGAAATGGTTGGCCAAGCGCACAAACTCAAAGTGCGTGATG
ATATTGGCCACTGGAAGTACAAAAACCTCGATCTGTCGCCGATCCTCTTTATTGAGCAGCCGCGCAGCGAAGATGGTATT
TACTGCCAGACTCAGCAGAACCACCAGCTCGAAAGCATACTGGATCGCACCTTGATCCAATTAGCAACGCCTGCCCTTGA
GCGTGGTGAAGCGGTCAAAGCAGAGCTACCGATCATCAACACCGATCGCAGTACCGGCACCATGTTGTCTAACGAAATCT
GTAAGGTTTACAAAGACCAAGGTCTACCACAGCCAATGCAGGTGAAATTCAACGGCAGTGCGGGACAATCTTTCGGGGCA
TTCCTCACTAAAGGCGTTTACTTTGAAGTGGAAGGCGATGCTAACGACTACTGGGGCAAAGGTCTTTCTGGTGGCACGCT
GGTGCTCTACCCGAACCGTAACGCCACCATAGTTCCGGAAGAGAACATTGTGGTCGGTAACGTCTGTTTCTACGGCGCAA
CCTCTGGCGAATCTTACATTCGCGGCCTAGCGGGCGAGCGTTTCTGCGTGCGTAACTCAGGTGCCAAAGTGGTGGTGGAA
GGTATCGGCGATCACGGCTGTGAATACATGACCGGCGGTGTCGCAGTGATCCTCGGTTCAACCGGCCGTAACTTCGCCGC
AGGTATGAGTGGCGGTGTGGCTTACGTGTGGGATAAATCTGGCGACTTCCAATCTAAGCTCAATGCAGAATTGGTTGATC
TGGACCCTATCGAAGCGGAAGACAGAGCCCTACTCAAAGAGATGTTAACCAAGCATGTTCAATTCACAGGAAGTGAAGTG
GCCAAAGCTTTCCTTGCCAACTTTGACGCAAGCCTAGCCACTATGGTCAAGGTCATGCCGCGTGATTACAAAGCGGTACT
GCAAAAGCGTAAAGCACAGGAGCAACAAGCCACATTAGCAGCGGAGGCGGTATAAATGGGTAAAGCAACCGGATTTTTAG
AATTTGGTCGTGAACTGCCGAAAAAAATCGACCCGGCAGAGCGCATCAAAAACAACAAAGAGTTTGTCCTTAACCAAGAG
TTTGGTAAGAAGATCAATCAGCAAGCTTCACGTTGTATGGATTGTGGCGTGCCGTTTTGTCATAACGGCTGCCCGATTGG
CAACATCATTCCCGAGTTTAACGATGCAGTGTATCGCGACAGTTGGGAAGAGGCTTGGAATATTCTGAGCTCGACCAACA
ACTTCCCAGAGTTTACCGGTCGTGTCTGCCCTGCACCTTGTGAAACCGCCTGTGTGCTTGGCATCAACCAAGATCCGATC
ACCATCTGTAACATTGAAAAAACCATTGTGGAACGTGCTTACCAAGAAGGCTATGCCAAGCCGAAAACGCCACGTTCACG
CACCGGAAAAACGGTCGCGATCATTGGCTCAGGCCCTGCGGGGCTGGCCGCGGCGGAGCAGTTGAATGCCGCGGGTCATA
GCGTCACCGTGTTTGAGCGGGATGAAAAAGTCGGCGGCTTGCTGCGCTTTGGCATTCCCGATTTCAAACTCGGTATGGAT
GTGATTGATCGCAAAATCAATCTGATGGAACAAGCGGGCGTTAAGTTCGTGGTCAATGCGCATATCGGTGTAGACATCAA
CGCTCAACAGTTGCGTCAGGAGTTTGATGCGGTATTGCTGACGGGCGGCTCAACCGTACCACGTGATCTGAGCATTCCCG
GACGTGATCTGAAAGGCGTTTACTTCGCGATGCAGTTCCTCGCGCAAAATAACCGCCGAGCCAATGGCATGGATCTGAAA
GGTGAAGAGATCCACGCTAAAGGCAAACATGTGGTAGTGATCGGAGGCGGCGATACTGGCTCCGACTGTGTCGGCACCTC
TAACCGCCACGGCGCTGCGAGTATCACTCAAGTGGAGATCATGCCGATCCCACCGCAAAAGCGCCCAGTGAATATGCCTT
GGCCGCAATATCCGATGATTCTGCGCACCTCTACCTCTCATGAAGAAGGCTGTGAGCGTCATTGGAACATCCTCACCAAA
GAGTTCATTGGTAATGAACAAGGTGAAGTGACGGGTCTACGCATCGCTGACATCGTTTGGAAAGATGCAGCCCCCGGTGA
GCGACCAAGCTTTGACGAAGTGGTGGGCAGTGAACGCGTCATTCCTTGTGATATGGCATTTCTGGCGATGGGCTTCTTGC
ATCCAGAGCCACACGGCGTGCTTGCTCAGTTGGGGATTAAGCTTGATGAGCGCGGCAATGTGGCGACGCAAGATTTTGCG
ACCAACCAAAAAGGCGTATTCGCCGCAGGTGATATGCGCACAGGCCAATCCTTGGTGGTGCGCTGTATCAACGAAGGTCG
CGAATGTGCGCGAGCCGTTGACACCTTCTTGATGGGCAATACCCATCTTGAGGCAAAAGCGGACTCACTCATGCTGTCAG
CATAATCCTCTGTTGGCGCGGGTGATGCATCCTCATCCGTGTCAACACAACCGTTTCCTTCCATATTGTTTTACTTCGGC
CAGCACTCCCTGCTGGCCTTTTTTATGCCTATTCTCATCACACGGGATAAAACCTTGAGTTATCTGTAACTGAGAGAAAA
CTATCCCATTGAATATAATGACATTATTTGAAGTATTCCTCGGCAAATACCCTGCAAACCCTATTTTCAACCAATAACTT
GACCTTTTGTACAATAAGCTATAGGTTGTGAATTCGGTGAAAATAAAATCCCGCAAAAATGTTAATTAATTAACCTGAAA
TGTTAGTTAATTATTCAAATTATAAAGATTTAAATGAATAGTTATACCCAAGCTACTTGAAGCCATCGTTAAACGGAAGT
GGATGAATCCCCATCAGCATAGATAACTATGTGATTGGAGTAGACAGACACCGCCCATACCGAGGCTGTTTCAAGGAGTA
AGGGAATTGTCATTTACTGTCTGGATGACAGAGATGCAAAGGGAGAATTGCAATGGCTCTATACGATCCAAGTCTTGAAA
AAGACAACTGTGGATTCGGCTTGATCGCGCACATGGAAGGGCAAGCCAGTCACAAACTCGTTCGTACCGCGATTTCAGCA
CTTGATCGCATGACTCACCGTGGCGGTATCGCCGCCGATGGTAAAACTGGTGATGGCTGTGGTCTGTTGCTGCAAAAACC
TGACTCTTATTTGCGCCTGATCGCAGAAGAGCAACATTGGAAACTCAGCAAACAGTACGCGATTGGCATGCTGTTTCTCA
GCCGAGATCCACACAAAGCGCAGCTGGCACAGCAAATTGTTAACCAAGAACTCGCTAAAGAAACCTTAAGCGTGGCAGGT
TGGCGCAAAGTGCCCACCAACCCGAAAGTGCTTGGCCCGATAGCCCTCGACTCTTTGCCCGATATTCAACAAGTCTTCAT
CTCCGCCCCGGCCGGTTGGCGTGAGCGCGATGTTGAGCGCCGTCTGTATATTGCGCGTCGTCGCATTGAAAAACAGATTA
CGGATGATCGCGATTTCTACATCTGCTCGCTCTCGACTCAAGTGTTGGTTTACAAAGGCCTGTGTATGCCCGCAGACCTA
CCACGCTTTTATCTCGACTTAGCCGATCTGCGTATGGAATCGGCGATTTGCTTGTTCCACCAACGTTTCTCCACCAATAC
TCAGCCACGCTGGCCGCTGGCTCAGCCGTTTCGCTATCTGGCGCACAATGGCGAAATCAACACCATTGAAGGTAACCGCC
AGTGGGCACGCGCTCGGGCTTATAAGTTCGCGTCACCGCTGCTGCCCGATTTGCAAAGCGCTGCCCCTTTTGTGAATGAA
ACCGGTTCGGACTCTTCGAGCCTAGACAACATGCTGGATCTGTTTTTAGCCGGCGGGATGGATATCTTCCGTGCGATGCG
CATGCTGGTTCCGCCCGCATGGCAAAACCATCCGGATATGGATCCGGATCTGCGTGCTTTCTACGATTTCAACTCCAAAC
ACATGGAGCCTTGGGATGGCCCGGCGGGGATCGTGCTGTCCGATGGTCGTTACGCCGCGTGTAACCTTGACCGTAACGGC
CTGCGTCCTGCGCGTTATGTGATCACCAAAGATAAGCTCATCACCCTCGCTTCAGAAGTCGGGATTTGGGATTACGCACC
AGATGAAGTGTCTGAAAAAGGTCGGGTTGGCCCCGGCGAGCTGCTGGTGATCGACACTCGCAAAGGCAAAATTTGGCAAT
CGAGCGAAATTGATAACGACCTAAAAAGCCGTCACCCCTATCGTGAGTGGATGGAAAATAACGTTCATAAACTCACGCCC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment