Commit a594e3f1 authored by Aaron Petkau's avatar Aaron Petkau

Adding functional tests for find-repeats.xml

parent ae5f3439
<tool id="findrepeat" name="Find Repeats" version ="0.0.2">
<description>Identify repeat elements using Mummer</description>
<requirements>
<requirement type="package" version="1.1">core-phylogenomics</requirement>
</requirements>
<requirements>
<requirement type="package" version="1.1">core-phylogenomics</requirement>
</requirements>
<command interpreter="perl">
/\$VCF2PSEUDO/find-repeats.pl -l $length -p $pid $fasta > $out
......@@ -18,17 +18,23 @@
<stdio>
<exit_code range="1:" level="fatal" description="Unknown error has occured"/>
</stdio>
<!--tests>
</tests-->
<tests>
<test>
<param name="length" value="150"/>
<param name="pid" value="90"/>
<param name="fasta" value="find-repeats-input-1.fasta"/>
<output name="out" file="find-repeats-output-1.tabular"/>
</test>
</tests>
<help>
Usage: ./find-repeats.pl [reference.fasta] --min-length [length] --min-pid [pid]
Parameters:
[reference.fasta]: A fasta reference file to search for repeats.
Options:
-l|--min-length: Minimum length of repeat region (150).
-p|--min-pid: Minimum PID of repeat region (90).
-k|--keep-temp: Keep around temporary nucmer/coords files (no).
-l|--min-length: Minimum length of repeat region (150).
-p|--min-pid: Minimum PID of repeat region (90).
-k|--keep-temp: Keep around temporary nucmer/coords files (no).
</help>
</tool>
>A
CCCGCTCGCCACGCTTTGGCCATAGTGCTGCCTTCTACGATGTGTAAACCGTGCAACTTAATGCCATCGGTGCCTACCTT
CAGTACTTGCTGTAACGTGGTGAGGTTTTCAGTGCGCTCTTCACCGGGTAACCCAACAATCAAGTGAGTACACACTTTGA
TACCTAACGCTCTAGCTTTGGCAGTGATCTCTGCGTAGCAGGCAAAATCGTGCCCGCGGTTAATGCGTTTTAAAGTCTGG
>B
CCCGCTCGCCACGCTTTGGCCATAGTGCTGCCTTCTACGATGTGTAAACCGTGCAACTTAATGCCATCGGTGCCTACCTT
CAGTACTTGCTGTAACGTGGTGAGGTTTTCAGTGCGCTCTTCACCGGGTAACCCAACAATCAAGTGAGTACACACTTTGA
TACCTAACGCTCTAGCTTTGGCAGTGATCTCTGCGTAGCAGGCAAAATCGTGCCCGCGGTTAATGCGTTTTAAAGTCTGG
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment