Commit 06af939a authored by Aaron Petkau's avatar Aaron Petkau

Merge branch 'feature/functional-tests' into 'development'

Feature/functional tests

Here's what I have so far for functional tests + documentation for running them.  Dataset collections + tests are broken for right now, but at least the other tools have a test that can be run.
parents dc8f5bd2 e005e7c0
Galaxy Core Phylogenomics Pipeline
==================================
This contains the Galaxy tool definitions and workflow definitions needed to install the [Core Phylogenomis Pipeline](https://github.com/apetkau/core-phylogenomics) into Galaxy.
This contains the Galaxy tool definitions and workflow definitions needed to install the [Core Phylogenomis Pipeline][] into Galaxy.
Authors
=======
......@@ -11,7 +11,7 @@ Philip Mabon, Aaron Petkau
Install
=======
This repository contains two main sections. A set of tools under `tools/` and a workflow implementing the core phylogenomics pipeline under `workflows/`. These can be packaged up and uploaded into a [Galaxy Tool Shed](https://wiki.galaxyproject.org/ToolShed) and then later installed to an instance of Galaxy. Instructions on how to install your own local Galaxy Tool Shed and Galaxy can be found at https://irida.corefacility.ca/gitlab/irida/irida-install-documentation/tree/feature/galaxy-setup/galaxy.
This repository contains two main sections. A set of tools under `tools/` and a workflow implementing the core phylogenomics pipeline under `workflows/`. These can be packaged up and uploaded into a [Galaxy Tool Shed][] and then later installed to an instance of Galaxy. Instructions on how to install your own local Galaxy Tool Shed and Galaxy can be found at [IRIDA Galaxy Setup][].
Step 1: Building Tool Shed Packages
-----------------------------------
......@@ -56,4 +56,20 @@ Once you have uploaded the packages to a Galaxy Tool Shed, you can install to a
Step 5: Test out your tool in Galaxy
------------------------------------
Once you've finished installing your tool, you should be able to test it out within Galaxy.
Once you've finished installing your tool, you should be able to test it out within Galaxy. This can be automated by running the functional tests using the commands. This is adapted from the [Testing Installed Tools][] document.
```bash
$ export GALAXY_TOOL_DEPENDENCY_DIR=/path/to/tool-dependencies
$ for i in `find $GALAXY_TOOL_DEPENDENCY_DIR -iname 'env.sh'`; do echo $i; source $i; done # must source all environments for tool dependencies
$ sh run_functional_tests.sh -installed
```
This should generate a report in the file `run_functional_tests.html`.
[Core Phylogenomis Pipeline]: https://github.com/apetkau/core-phylogenomics
[Galaxy Tool Shed]: https://wiki.galaxyproject.org/ToolShed
[Testing Installed Tools]: https://wiki.galaxyproject.org/TestingInstalledTools
[IRIDA Galaxy Setup]: https://irida.corefacility.ca/gitlab/irida/irida-install-documentation/tree/master/galaxy
[Automated Tool Tests]: https://wiki.galaxyproject.org/AutomatedToolTests
[Hosting a Local Tool Shed]: https://wiki.galaxyproject.org/HostingALocalToolShed
[Install and Test Certification]: https://wiki.galaxyproject.org/InstallAndTestCertification
......@@ -13,8 +13,8 @@ then
mkdir $BUILD_DIR
fi
tar -C $TOOLS_DIR -czf $BUILD_DIR/core_phylogenomics_pipeline.tar.gz core_phylogenomics_pipeline
tar -C $WORKFLOWS_DIR -czf $BUILD_DIR/core_phylogenomics_pipeline_workflow.tar.gz core_phylogenomics_pipeline_workflow
tar -C $TOOLS_DIR/core_phylogenomics_pipeline -czf $BUILD_DIR/core_phylogenomics_pipeline.tar.gz .
tar -C $WORKFLOWS_DIR/core_phylogenomics_pipeline_workflow -czf $BUILD_DIR/core_phylogenomics_pipeline_workflow.tar.gz .
echo "Successfully built tarballs"
ls -l $BUILD_DIR/*.tar.gz
......
......@@ -15,8 +15,12 @@
</outputs>
<stdio>
</stdio>
<!--tests>
</tests-->
<tests>
<test>
<param name="vcf" value="filterVcf.input.1.vcf"/>
<output name="vcfout" file="filterVcf.output.1.vcf"/>
</test>
</tests>
<help>
Filter out indels and complex variants from VCF file
......
......@@ -18,8 +18,14 @@
<stdio>
<exit_code range="1:" level="fatal" description="Unknown error has occured"/>
</stdio>
<!--tests>
</tests-->
<tests>
<test>
<param name="length" value="150"/>
<param name="pid" value="90"/>
<param name="fasta" value="find-repeats-input-1.fasta"/>
<output name="out" file="find-repeats-output-1.tabular"/>
</test>
</tests>
<help>
Usage: ./find-repeats.pl [reference.fasta] --min-length [length] --min-pid [pid]
......
......@@ -12,12 +12,16 @@
<param name="phylip" type="data" label="Phylip file" format="phylip"/>
</inputs>
<outputs>
<data format="csv" name="csv" />
<data format="csv" name="csv"/>
</outputs>
<stdio>
</stdio>
<!--tests>
</tests-->
<tests>
<test>
<param name="phylip" value="pseudoalign-3.phy"/>
<output name="csv" file="pseudoalign-3.phy.out"/>
</test>
</tests>
<help>
Create SNP matrix from Phylip file format
......
##fileformat=VCFv4.1
##fileDate=20140423
##source=freeBayes version 0.9.8
##reference=/home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/reference/2010EL-1749.2010EL-1786-c1_2000_2400kb.fasta
##phasing=none
##commandline="/opt/freebayes/freebayes --bam /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/bam/2010EL-1749.bam --vcf /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/vcf/2010EL-1749.vcf --fasta-reference /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/reference/2010EL-1749.2010EL-1786-c1_2000_2400kb.fasta --min-coverage 2 --pvar 0 --ploidy 1 --left-align-indels --min-mapping-quality 30 --min-base-quality 30 --min-alternate-fraction 0.75"
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observations">
##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations">
##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio. Ratio between depth in samples with each called alternate allele and those without.">
##INFO=<ID=XRM,Number=1,Type=Float,Description="Reference allele read mismatch rate: The rate of SNPs + MNPs + INDELs in reads supporting the reference allele.">
##INFO=<ID=XRS,Number=1,Type=Float,Description="Reference allele read SNP rate: The rate of per-base mismatches (SNPs + MNPs) in reads supporting the reference allele.">
##INFO=<ID=XRI,Number=1,Type=Float,Description="Reference allele read INDEL rate: The rate of INDELs (gaps) in reads supporting the reference allele.">
##INFO=<ID=XAM,Number=A,Type=Float,Description="Alternate allele read mismatch rate: The rate of SNPs + MNPs + INDELs in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=XAS,Number=A,Type=Float,Description="Alternate allele read SNP rate: The rate of per-base mismatches (SNPs + MNPs) in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=XAI,Number=A,Type=Float,Description="Alternate allele read INDEL rate: The rate of INDELs (gaps) in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
##INFO=<ID=BVAR,Number=0,Type=Flag,Description="The best genotype combination in the posterior is variant (non homozygous).">
##INFO=<ID=CpG,Number=0,Type=Flag,Description="CpG site (either CpG, TpG or CpA)">
##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing. Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
##INFO=<ID=HWE,Number=1,Type=Float,Description="Phred-scaled discrete HWE prior probability of the genotyping across all samples.">
##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
##FORMAT=<ID=GLE,Number=1,Type=String,Description="Genotype Likelihood Explicit, same as GL, but with tags to indicate the specific genotype. For instance, 0^-75.22|1^-223.42|0/0^-323.03|1/0^-99.29|1/1^-802.53 represents both haploid and diploid genotype likilehoods in a biallelic context">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT unknown
gi|360034408|ref|NC_016445.1|_2000000_2400000 128 . GA AT 197.867 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=3;CIGAR=1X;DP=3;DPRA=0;EPP=3.73412;EPPR=0;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=0;NS=1;NUMALT=1;ODDS=45.5605;PAIRED=0;PAIREDR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAP=3.73412;SRP=0;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:3:0:0:3:212:-19.7867,0
gi|360034408|ref|NC_016445.1|_2000000_2400000 256 . A C 250.1 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=6;CIGAR=1X;DP=8;DPRA=0;EPP=8.80089;EPPR=3.0103;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=54;NS=1;NUMALT=1;ODDS=57.5877;PAIRED=0;PAIREDR=0;RO=2;RPP=8.80089;RPPR=7.35324;RUN=1;SAP=4.45795;SRP=3.0103;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:8:2:142:6:420:-38.5,-13.49
gi|360034408|ref|NC_016445.1|_2000000_2400000 512 . AT C 250.1 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=6;CIGAR=1X;DP=8;DPRA=0;EPP=8.80089;EPPR=3.0103;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=54;NS=1;NUMALT=1;ODDS=57.5877;PAIRED=0;PAIREDR=0;RO=2;RPP=8.80089;RPPR=7.35324;RUN=1;SAP=4.45795;SRP=3.0103;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:8:2:142:6:420:-38.5,-13.49
##fileformat=VCFv4.1
##fileDate=20140423
##source=freeBayes version 0.9.8
##reference=/home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/reference/2010EL-1749.2010EL-1786-c1_2000_2400kb.fasta
##phasing=none
##commandline="/opt/freebayes/freebayes --bam /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/bam/2010EL-1749.bam --vcf /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/vcf/2010EL-1749.vcf --fasta-reference /home/aaron/microbialinformatics2014/core-snp-tutorial/output-10-subsample/reference/2010EL-1749.2010EL-1786-c1_2000_2400kb.fasta --min-coverage 2 --pvar 0 --ploidy 1 --left-align-indels --min-mapping-quality 30 --min-base-quality 30 --min-alternate-fraction 0.75"
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observations">
##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations">
##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio. Ratio between depth in samples with each called alternate allele and those without.">
##INFO=<ID=XRM,Number=1,Type=Float,Description="Reference allele read mismatch rate: The rate of SNPs + MNPs + INDELs in reads supporting the reference allele.">
##INFO=<ID=XRS,Number=1,Type=Float,Description="Reference allele read SNP rate: The rate of per-base mismatches (SNPs + MNPs) in reads supporting the reference allele.">
##INFO=<ID=XRI,Number=1,Type=Float,Description="Reference allele read INDEL rate: The rate of INDELs (gaps) in reads supporting the reference allele.">
##INFO=<ID=XAM,Number=A,Type=Float,Description="Alternate allele read mismatch rate: The rate of SNPs + MNPs + INDELs in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=XAS,Number=A,Type=Float,Description="Alternate allele read SNP rate: The rate of per-base mismatches (SNPs + MNPs) in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=XAI,Number=A,Type=Float,Description="Alternate allele read INDEL rate: The rate of INDELs (gaps) in reads supporting the alternate allele, excluding the called variant.">
##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
##INFO=<ID=BVAR,Number=0,Type=Flag,Description="The best genotype combination in the posterior is variant (non homozygous).">
##INFO=<ID=CpG,Number=0,Type=Flag,Description="CpG site (either CpG, TpG or CpA)">
##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing. Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
##INFO=<ID=HWE,Number=1,Type=Float,Description="Phred-scaled discrete HWE prior probability of the genotyping across all samples.">
##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
##FORMAT=<ID=GLE,Number=1,Type=String,Description="Genotype Likelihood Explicit, same as GL, but with tags to indicate the specific genotype. For instance, 0^-75.22|1^-223.42|0/0^-323.03|1/0^-99.29|1/1^-802.53 represents both haploid and diploid genotype likilehoods in a biallelic context">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT unknown
gi|360034408|ref|NC_016445.1|_2000000_2400000 128 . G A 197.867 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=3;CIGAR=1X;DP=3;DPRA=0;EPP=3.73412;EPPR=0;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=0;NS=1;NUMALT=1;ODDS=45.5605;PAIRED=0;PAIREDR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAP=3.73412;SRP=0;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:3:0:0:3:212:-19.7867,0
gi|360034408|ref|NC_016445.1|_2000000_2400000 129 . A T 197.867 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=3;CIGAR=1X;DP=3;DPRA=0;EPP=3.73412;EPPR=0;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=0;NS=1;NUMALT=1;ODDS=45.5605;PAIRED=0;PAIREDR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAP=3.73412;SRP=0;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:3:0:0:3:212:-19.7867,0
gi|360034408|ref|NC_016445.1|_2000000_2400000 256 . A C 250.1 . AB=0;ABP=0;AC=1;AF=1;AN=1;AO=6;CIGAR=1X;DP=8;DPRA=0;EPP=8.80089;EPPR=3.0103;HWE=-0;LEN=1;MEANALT=1;MQM=54;MQMR=54;NS=1;NUMALT=1;ODDS=57.5877;PAIRED=0;PAIREDR=0;RO=2;RPP=8.80089;RPPR=7.35324;RUN=1;SAP=4.45795;SRP=3.0103;TYPE=snp;XAI=0;XAM=0;XAS=0;XRI=0;XRM=0;XRS=0;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1:50000:8:2:142:6:420:-38.5,-13.49
>A
CCCGCTCGCCACGCTTTGGCCATAGTGCTGCCTTCTACGATGTGTAAACCGTGCAACTTAATGCCATCGGTGCCTACCTT
CAGTACTTGCTGTAACGTGGTGAGGTTTTCAGTGCGCTCTTCACCGGGTAACCCAACAATCAAGTGAGTACACACTTTGA
TACCTAACGCTCTAGCTTTGGCAGTGATCTCTGCGTAGCAGGCAAAATCGTGCCCGCGGTTAATGCGTTTTAAAGTCTGG
>B
CCCGCTCGCCACGCTTTGGCCATAGTGCTGCCTTCTACGATGTGTAAACCGTGCAACTTAATGCCATCGGTGCCTACCTT
CAGTACTTGCTGTAACGTGGTGAGGTTTTCAGTGCGCTCTTCACCGGGTAACCCAACAATCAAGTGAGTACACACTTTGA
TACCTAACGCTCTAGCTTTGGCAGTGATCTCTGCGTAGCAGGCAAAATCGTGCCCGCGGTTAATGCGTTTTAAAGTCTGG
#Chromosome Position Status Reference v1 v2
ref1 2 valid T A A
ref1 5 filtered-invalid C A N
ref1 7 filtered-coverage G T -
ref2 3 valid A T A
......@@ -54,8 +54,27 @@
</stdio>
<!--tests>
<test>
<param name="input" value="fa_gc_content_input.fa"/>
<output name="out_file1" file="fa_gc_content_output.txt"/>
<param name="reference" value="vcf2pseudoalignment.input.1.reference.fasta"/>
<param name="coverage" value="4"/>
<param name="invalid" value="vcf2pseudoalignment.input.1.invalid_positions.tsv"/>
<param name="ambiguous" value="true"/>
<param name="freebayes_collection">
<collection type="list">
<element name="name1" value="vcf2pseudoalignment.input.1.v1.vcf.gz"/>
<element name="name2" value="vcf2pseudoalignment.input.1.v2.vcf.gz"/>
</collection>
</param>
<param name="mpileup_collection">
<collection type="list">
<element name="name1" value="vcf2pseudoalignment.input.1.mpileup.v1.vcf.gz"/>
<element name="name2" value="vcf2pseudoalignment.input.1.mpileup.v2.vcf.gz"/>
</collection>
</param>
<param name="numcpus" value="4"/>
<output name="tabular" file="vcf2pseudoalignment.output.1.positions.tsv"/>
<output name="fasta" file="vcf2pseudoalignment.output.1.expected.fasta"/>
<output name="phylip" file="vcf2pseudoalignment.output.1.expected.phy"/>
</test>
</tests-->
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment